they would B alter the space
PLEASE HELPPPPPPPPPP!!!!!!! Explain how ATP and ADP act as allosteric regulators of enzymes that are responsible for ATP production, and how that is an example of feedback inhibition.
Answer:
The molecules that bind cellular respiration enzymes act as signals, giving the enzyme information about the cell's energy state. ATP and ADP are examples of molecules that regulate cellular respiration enzymes. ATP, for instance, is a "stop" signal: high levels mean that the cell has enough ATP and does not need to make more through cellular respiration.
This is a case of feedback inhibition in which a product feeds back to shut down its pathways.
Answer:
Specific enzymes of the electron transport chain are unaffected by feedback inhibition, but the rate of electron transport through the pathway is affected by the levels of ADP and ATP. Greater ATP consumption by a cell is indicated by a buildup of ADP. As ATP usage decreases, the concentration of ADP decreases: ATP begins to build up in the cell.
Explanation:
what would happen if someone with celiac disease ate a grilled cheese sandwich ? will give brainlist !
Answer:
If we are assuming the grilled cheese has gluten, then there care be a reaction. then causing weight loss, upset stomach. etc.
Which of the following best describes a benefit of studying biology.
a. One is able to experiment on a variety of animals.
b. One is able to intelligently debate issues such as cloning.
c. One is able to preserve the animals that are extinct.
d. One is able to understand the causes of changes in weather.
Answer:
The statement that best describes the benefit of studying biology is the ability to intelligently debate issues such as cloning.
Explanation:
Biology encompasses the study of all known forms of life, including their anatomy, organization, functioning and interactions.
One of the advantages of the knowledge acquired through biology is to be able to participate in works and discussions involving subjects related to living beings, including cloning.
The other options are not correct because:
a and c. The ability to experiment on animals or preserve animals that are extinct is reserved for scientists with a deep knowledge of biology and its fields.
d. Understanding the causes of wheather change does not correspond to knowledge in biology
Which homeostatic process is characterized by the diffusion of only water molecules?
active transport
osmosis
passive transport
dynamic equilibrium
Answer:
It is osmosis
Explanation:
A convalent bond is formed as a result of a
Answer:
A covalent bond is formed as the result of sharing electrons.
Explanation:
HOPE THIS HELPPSS :)
Which of the following is the primary function of the nucleus?
Answer:
The nucleus has very important roles to play. As it contains genetic material, it coordinates cell activities like protein synthesis and cell division. Anatomically the nucleus is made up of several components: nuclear envelope, nuclear lamina, nucleolus, chromosomes, nucleoplasm are some of these components.
Explanation:
The nucleus controls and regulates the activities of the cellular (e.g., growth and metabolism) and carries the genes and systems that include the hereditary statistics.
What are the two number one capabilities of the nucleus?The nucleus has 2 primary features: it's miles responsible for storing the cell's hereditary cloth or the DNA. it is liable for coordinating the various essential cell activities along with protein synthesis, cellular division, growth, and a bunch of other critical features.
Learn more about nucleus here: https://brainly.com/question/11295582
#SPJ2
Escribe lo que piensa de la siguiente suposición si es cierta o no: " Todas las semillas de una fruta sobrevivirán, se convertirán en adultas y tendrán sus propias frutas. " Describa de si esta suposición es verdadera para otros organismos como las bacterias y animales además de las plantas)
Answer:
Esta suposición no es realista, muchas de las semillas no llegarán a la etapa adulta y por lo tanto no podrán generar nueva progenie
Explanation:
Acorde a la teoría de la evolución por selección natural planteada por Darwin, solamente aquellos organismos que se encuentren mejor adaptados al ambiente en el que viven podrán sobrevivir y de este modo perpetuar sus genes en la progenie. Este es un principio que aplica a todos los tipos de organismos vivientes (es decir, plantas, animales, bacterias, etc). Darwin definió a este proceso evolutivo como 'descendencia con modificación', donde aquellos organismos que se encuentren mejor adaptados a su ambiente transmitirán sus rasgos a la descendencia, mientras que aquellos que no se encuentren suficientemente adaptados no podrán sobrevivir.
what would most likely occur during the formation of rocks.
Answer:
Solidifications of molten materials.
factors that affects potential and kinetic energy
Answer:
See Below.
Explanation:
Kinetic energy depends on the potential energy of an object but they both have similar factors as they are inter-related. Kinetic energy is the motion of the object depending on its potential.
Potential energy is a positional based value, it literally means what it says, the potential or possibility for the creation of energy.
To demonstrate this think of dropping a ball off of a building:
The potential energy of that ball will be greater if the ball is dropped from a higher floor than a lower one. It will also be greater or lower depending on the mass of the object (from the formula in physics F=ma or Force = mass x acceleration). Gravity is another factor. If we drop a ball on Earth and then on the Moon, where the gravitational pull is 1/6th that of the Earth's, of course it will not be the same.Which statement correctly classifies ATP, cytoplasm, and mitochondria? (1 point)
Mitochondria are found in the cytoplasm, and cytoplasm is found in ATP.
ATP is found in the cytoplasm, and cytoplasm is found in the mitochondria.
Cytoplasm is found in ATP, and ATP is found in the mitochondria.
ATP is found in mitochondria, and mitochondria are found in the cytoplasm.
The statement that correctly classifies ATP, cytoplasm, and mitochondria is "ATP is found in mitochondria, and mitochondria are found in the cytoplasm"
MITOCHONDRIA:
Mitochondria are membrane bound organelles found in eukaryotic cells. They are the site of cellular respiration, which produces energy in form of ATP. Since ATP molecules are produced in the mitochondria, this means that ATP are found there.CYTOPLASM:
Cytoplasm is a gelatinous material that harbors every cellular organelle. The cytoplasm is bounded and protected by the cell membrane. This means that mitochondria is embedded in the cytoplasm of a cell. Therefore, the statement that correctly classifies ATP, cytoplasm, and mitochondria is "ATP is found in mitochondria, and mitochondria are found in the cytoplasm"Learn more: https://brainly.com/question/14740753?referrer=searchResults
Answer:
ATP is found in mitochondria, and mitochondria are found in the cytoplasm.
Explanation:
I hate to be one of those people, but I took the quiz.. :,D
The sun's energy is released when ____ this converted into energy
mass
liquid
light
chlorophyll
How does the process of osmosis ensure that our cells maintain homeostasis?
Answer:
Osmotic homeostasis is maintained despite the influence of external factors such as temperature, diet, and weather conditions. Osmosis is the diffusion of water across a membrane in response to osmotic pressure caused by an imbalance of molecules on either side of the membrane.
Which level of organization is characterized by a group of cells that work together to perform a common function?
organ
O tissue
O organ system
O organism
Save and Exit
Next
Submit
lark this and return
Answer:
Tissue
Explanation:
Tissue is a group of cells that work together for a specific function such as making your muscles move.
Tissue level of organization is characterized by a group of cells that work together to perform a common function
A group of cells that work together to perform a common function is known as a tissue. Tissues can be classified into four main types: epithelial, connective, muscular, and nervous tissue.
Epithelial tissues are responsible for covering and lining surfaces, while connective tissues provide support and protection to the body. Muscular tissues enable movement, while nervous tissues control and coordinate body functions.
Therefore, Tissues are the building blocks of organs that are made up from cells , which in turn make up organ systems, and ultimately form an organism.
Learn more about Tissue at :
https://brainly.com/question/17664886
#SPJ7
I need to know what the Ghrelin is for school
Answer:
It is a hormone that increases appetite
Which statement best describes why the body tries to maintain homeostasis?
O The body must maintain homeostasis so that the internal environment matches the
outside environment
The body must maintain homeostasis so that the internal environment stays the same if the outside
environment changes.
The body must maintain homeostasis to make sure that a person's heart and respiration rates are
the same.
Answer:
I would go with B:
The body must maintain homeostasis so that the internal environment stays the same if the outside
Homeostasis is the process of a state of steady internal, mental, chemical, and physical conditions of the body.
The correct answer is:
Option B. The body must maintain homeostasis so that the internal environment stays the same if the outside environment changes.
Homeostasis can be explained as:
It is the self-regulating process in which the body tends to keep the internal, physical, and chemical conditions of the body in a steady and equilibrium state. It generally refers to the stable internal conditions or maintaining the steady phase of the body with respect to changes in the environment. Sweating is one of the processes in which the body tends to maintain homeostasis by releasing excess heat in the hot climate.
Thus, the correct answer is Option B.
To know more about homeostasis, refer to the following link:
https://brainly.com/question/860558
A teacher boils 200 g of juice in a sealed pot. The
vaporized juice condenses on the pot's lid and then drips
down the inside of the pot. Finally, the teacher measures
the mass of the contents of the sealed pot again.
What is the total mass of juice in the closed system?
A. 200 g
B. 100 g
C. 400 g
D. 300 g
Answer:
A
Explanation:
No matter was lost in the boiling and since it is a closed system the mass will stay the same unless released otherwise
Answer:A
Explanation:
Just took the quiz
Which study would have produced the least trustworthy results?
Answer:
A
Explanation:
HELP! I WILL NAME YOU BRAINIEST !!!
Two objects, a box weighing 103 kg and a football weighing 0.41 kg, are dropped at the same time from the top of a 98 m tall building. If air resistance is negligible, which of the two will touch the ground first?
Answer:
The box would it weighs more. I hope this helps. so sorry if this is wrong.
Explanation:
In the rock cycle, what happens to the magma and lava once they cool and harden?
Answer:
For magma to become sediment, it would first cool and harden and become igneous rock. Weathering and erosion would expose the igneous rock and break it into sediments.
Answer:It moldens into a ingenious rock or obsidian
Explanation:After magma is cooled a cool air current flows throw the magma and it slowly start to harden into a obsidian like shape and makes a ingenious rock and basically cools it from the inside out turn it into a charcoaly obsidian
why do we need glucose
Answer:
Our brain wouldn't be able to work because it's the main source of fuel for our brains.
Explanation:
because it's the main source of fuel for our brains.
Which of the following individuals is maintaining homeostasis?
O Karen's heart rate is faster than the normal range.
O Bruce is vomiting uncontrollably and losing large amounts of water.
O Samantha is sweating while out for a jog.
O Evelyn cannot catch her breath because her respiration rate is racing.
Answer:
C
Explanation:
thats the only answer that makes sense in order for the body to remain in balance
hope this is right and helps <3
Answer:
Samantha is sweating while out for a jog
Explanation:
Sweating maintains homeostasis, as it helps to cool down one's body temperature and maintain a normal and healthy temperature in the body.
Samantha sweating while jogging represents how her body is maintaining homeostasis.
Her body is producing sweat in order to regulate her body temperature and keep the body at homeostasis.
Help ASAP!!! You’ll get brainiest if you do it right!
What is the complementary DNA strand TAC GGC CGT TAT
Answer:
1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
All living cells have the same organelles.
true or false
Plant cell walls are primarily made of sugar.
true or false
The environment can cause the shape of a protein to change.
true or false
Turgor pressure is a result of a central vacuole being low or nearly empty of water.
true or false
Mitochondria make sugar for animal cells.
true or false
The space between organelles in a cell is just water
true or false
Proteins are what allow cells to move
true or false
Catalysts are polysaccharide enymes.
true or false
Of the 5 nucleotides used in RNA and DNA, only one (A) is used for energy transport in the cell.
true or false
Changing the shape of the active site of an enzyme will probably allow it to catalyze more reactions.
true or false
Denaturing a protein makes it permanently unusable by breaking peptide bonds.
true or false
Hydrogen bonds are responsible for the common secondary structures in protein folding.
true or false
Water is an organic molecule.
true or false
Sugars are organic molecules
true or false
Answer:
Question 1 - false
Question 2 - true
Question 3 - true
Question 4 - false
Question 5 - false
Question 6 - false
Question 7 - false
Question 8 - true
Question 9 - true
Question 10 - false
Question 11 - false
Question - false
Question 12 - true
Question 13 - false
Question 14 - true
Answer:
1) All living cells have the same organelles.
false
2) Plant cell walls are primarily made of sugar.
true
3) The environment can cause the shape of a protein to change.
true
4) Turgor pressure is a result of a central vacuole being low or nearly empty of water.
false
5) Mitochondria make sugar for animal cells.
false
6) The space between organelles in a cell is just water
false
7) Proteins are what allow cells to move
true
8) Catalysts are polysaccharide enzymes.
false
9) Of the 5 nucleotides used in RNA and DNA, only one (A) is used for energy transport in the cell.
false
10) Changing the shape of the active site of an enzyme will probably allow it to catalyze more reactions.
false
11) Denaturing a protein makes it permanently unusable by breaking peptide bonds.
false
12) Hydrogen bonds are responsible for the common secondary structures in protein folding.
true
13) Water is an organic molecule.
false
14) Sugars are organic molecules
true
Explanation:
Just took the test!
How do the isotopes of hydrogen differ? *
Answer:
D. in the number of neutrons :)
Explanation:
An isotope is one of two or more forms of the same chemical element. Different isotopes of an element have the same number of protons in the nucleus, giving them the same atomic number, but a different number of neutrons giving each elemental isotope a different atomic weight.
Riparian zones can reduce the impact of water pollution. Please select the best answer from the choices provided True or False
Answer:
It true did the test just now
Explanation:
True. Riparian zones can reduce the impact of water pollution.
What are Riparian Zones?Riparian zones are the areas of land located along the banks of rivers and streams. They are important ecosystems that provide a variety of ecological, hydrological, and biological services, such as water filtration, flood control, habitat for wildlife, and recreation opportunities.
Riparian zones are also crucial for maintaining the overall health of river systems and for mitigating the impacts of human activities such as agriculture, urbanization, and resource extraction.
Learn more about Riparian Zones, here:
https://brainly.com/question/17701006
#SPJ6
Please help me with this.
Choose one of these career fields:
- astronomer
- geologist
- meteorologist (it can either be this)
- oceanographer (or this)
- List three tasks this type of scientist completes most days.
- List a location where such a scientist may work.
- Identify three reasons why this type of scientist's work is important.
- Identify what course of study is necessary to work in this field of science, as well as how many years of study are necessary to complete a degree in this field.
Answer:
geologist may be
Explanation:
Photosynthesis and cellular respiration both involve the use and release of gases. Which statement correctly identifies the role of gases in the two processes
Answer:
You have no options for me to choose from, but I'm going to make a wordy response anyway. The answer is stated below:
Explanation:
Cellular respiration uses carbon dioxide and releases oxygen, while photosynthesis uses oxygen and releases carbon dioxide.
Cellular respiration uses carbon dioxide and releases oxygen, while photosynthesis uses oxygen and releases carbon dioxide.
What is photosynthesis?Photosynthesis uses carbon dioxide and releases oxygen and cellular respiration uses oxygen and release carbon dioxide.
Photosynthesis is the process in which green plants prepare their own food in the presence of sunlight and light energy is converted into chemical energy by the process of cellular respiration.
The process of photosynthesis takes place in green plants only due to presence of chlorophyll and materials such as sunlight, water, carbon dioxide is required for the process of photosynthesis.
The equation of photosynthesis is represented below:
6CO2+ 6H2O - C6H12O6 + 6O2
The process of food manufacturing in plant is done through photosynthesis and the plants are known as autotrophs as they are the producers.
In the process of photosynthesis the reactant have 6 carbon dioxide molecules and six water molecules, and light energy converted into chemical energy due to presence of chlorophyll.
Therefore, Cellular respiration uses carbon dioxide and releases oxygen, while photosynthesis uses oxygen and releases carbon dioxide.
Learn more about photosynthesis here:
https://brainly.com/question/1388366
#SPJ6
Describe one similarity and one difference
between the structure of a euglena and
an amoeba.
Answer:
can you give me a pic????
A classmate argues that Schwann and Schleiden are responsible for the cell theory. How do you respond? Cite facts and use logical reasoning to support your argument.
Answer:
Yes.
Explanation:
Yes, Schwann and Schleiden are responsible for the cell theory, both the scientists presented the cell theory in 1839. I agree with the argument of my classmate because the person who first presented cell theory was both Schwann and Schleiden. Schwann works on plant cell whereas Schleiden works on animal cell and formulate cell theory. So my classmate's argument is right about cell theory.
Schwan and Schleiden proposed the first cell theory, suggesting spontaneous generation. Virchow changed it proposing cell division. After many years and the contribution of many researchers, the modern cell theory emerged.
---------------------------------------------------
Schwann studied animal tissues. Through careful observation, he concluded that all animal tissues were made of cells.
Simultaneously, Schleiden arrives at the same conclusion when studying vegetable tissues.
Around 1830, they met and together proposed the first cell theory. The theory stated that:
1. Every living being is made of cells.
2. Cell is the basic unit of life.
3. Cells are originated from spontaneous generation.
Virchow, who studied human tissues, sow the cell in its dividing process.
He proposed that cells were not originated from spontaneous generation, as Schwann and Schleiden had stated.
Instead, he said that cells were the product of other pre-existing cells and were originated by cellular division.
Virchow rejected the third state of Schwann and Schleiden’s ideas.
According to these sequence of events, the original cell theory changed to
1. Every living being is made of cells.
2. Cell is the basic unit of life.
3. Cells are originated by cellular division.
After many years of continuous studies about cells and their functions, the modern cell theory emerged.
In general terms, the modern theory can be resumed as,
1. Every living being -unicellular or multicellular- is made of cells, which are the most basic units of life.
2. Cell control the vital functions of organisms.
3. Cells proceed from preexistant prokaryotic cells, and are originated by cellular division.
--------------------------------------
Related link: https://brainly.com/question/4695161?referrer=searchResults
what is the energy that is released from glucose by cellular respiration
Answer:
ATP
Explanation:
glucose splits into two pyruvic acid molecules, which in turn, release ATP (Adenosine triphosphate).
