The limiting factors for these scenarios are density dependant or density-independent.
The growth or decrease of a population depends on factors that can or cannot be related to the number of inhabitants that the population has.
Density dependant limiting factors: the growth rate of a population changes due to the increase in a population's density, that is to say, the number of inhabitants, has a direct impact on the growth or decrease of this population.
Density Independent limiting factors: the growth rate of a population changes due to factors that are not related to the population itself. In other words, they are external factors, such as a volcanic eruption, that affect the rate.
In conclusion, a volcanic eruption covering everything in ash and killing almost all living things is a density-independent limiting factor. The increase in the population of elks and the decrease in their food source is a density dependant limiting factor, which makes elks compete for food. Lastly, part of a forest being clear cut to make room for buildings, and decreasing the available habitat for species is a density-independent limiting factor.
Learn more at:
https://brainly.com/question/12655151
How does the process of osmosis ensure that our cells maintain homeostasis?
Answer:
Osmotic homeostasis is maintained despite the influence of external factors such as temperature, diet, and weather conditions. Osmosis is the diffusion of water across a membrane in response to osmotic pressure caused by an imbalance of molecules on either side of the membrane.
which one of these situations is commonly caused by acid rain?
a. people being poisoned by drinking water
b. fish and birds in freshwater habitats dying off
c. people receiving acid burns on there skin
d. whales and dolphins dying off in the oceans
A situation that is commonly caused by acid rain is the dying off of fish and birds in freshwater habitats. Thus, the correct option for this question is B.
What do you mean by Acid rain?Acid rain may be defined as a type of precipitation that correspondingly include acidic components, like sulfuric acid, nitric acid, etc. that fall to the ground from the atmosphere in wet or dry forms like rain, fog, hail, etc.
The pH of acid rain is generally low compared to normal water. So, it causes numerous impacts on the earth's surface. But the most consequential influence of acid rain is the destruction of fish and birds in freshwater habitats.
It generally lowers the pH of the freshwater ecosystem and makes it unfavorable for many organisms like producers, small fishes, birds, etc. They cannot adapt themselves to such lower pH and have to dye off.
Therefore, the correct option for this question is B.
To learn more about Acid rain, refer to the link:
https://brainly.com/question/718250
#SPJ2
Root cells of plants take in some minerals from the surrounding soil by spending energy. After the plant obtains enough minerals to maintain health, the plant will continue to absorb minerals from the soil. Which reason best explains why root cells need to spend energy in order to transport some minerals into cells?
The question is incomplete; the complete question is;
Root cells of plants take in some minerals from the surrounding soil by spending energy. After the plant obtains enough minerals to maintain health, the plant will continue to absorb minerals from the soil. Which reason best explains why root cells need to spend energy in order to transport some minerals into cells?
Root cells are unable to use sunlight energy for mineral uptake.
Mineral concentration is higher in root cells than in the surrounding soil
Cell membrane pores in roots are too small for passive uptake of minerals
Cell membranes in roots lack proteins for the passage of minerals.
Answer:
Mineral concentration is higher in root cells than in the surrounding soil
Explanation:
Mineral uptake by plant roots occurs by active transport of ions into the cells of root hairs, this process requires energy.
The concentration of minerals in the soil is quite low. The root hair cells of plants possess carrier proteins that carry mineral ions and move them into the cell against existing concentration gradient. This process requires energy and is known as active transport.
Cell size is limited to:
a. Thickness of the cell wall
b. Size of the cell's nucleus
c. Cell's surface area-to-volume
ratio
d. Amount of cytoplasm in the
cell
Answer:
C
Explanation:
I'm pretty sure it's either C or B
5. network of complex interactions formed by the feeding relationships among the
various organisms in an ecosystem
A network of complex interactions formed by the feeding relationships among the various organisms in an ecosystem is known as Food web.
What is a food web?A food web is the natural interconnection of the different food chains and a graphical representation of what-eats-what in an ecological community in the nature. Another name used for the food web is the consumer-resource system.
Organisms which are present in the food webs are grouped into different categories are called as trophic levels. These levels are divided into producers, consumers, and decomposers.
Food web are the interactions which integrates the transfer of matter and energy between the living organisms which eat, and are being eaten by other organisms, capturing thus essential information about the species interactions, materials flow, community structure, and the ecosystem functioning.
Learn more about Food web here:
https://brainly.com/question/18816028
#SPJ6
How can DNA be useful in phylogeny? Question 14 options: A) DNA from every organism in a clade is sequenced to identify genetic mutations that have occurred. B) DNA sequences from different species can be compared, giving us more information about their evolutionary relationships. C) DNA sequences are rearranged to predict how species could evolve in the future. D) DNA isn't useful in phylogeny, as morphological characteristics are used exclusively in phylogeny.
Answer:
The correct answer is - option B. DNA sequences from different species can be compared, giving us more information about their evolutionary relationships.
Explanation:
The study of the evolution of a species in a longer period of time and its evolutionary relation with other species is phylogeny. DNA is the basis of the molecular phylogeny of a species to find out the evolution of species.
Genetic mutations, a sequence of nucleotides, and other information of DNA helps in the establishment of divergence from common ancestry. By comparing the information it gives an idea about the evolutionary ancestry of two or more species.
Question 7 Which of the following is NOT paired correctly? fat- lipid starch-nucleic acid glucose Carbohydrate enzyme protein
Answer:
Starch-nucleic acid is not paired correctly.
What makes a scientific observation different from day to day observations?
what would most likely occur during the formation of rocks.
Answer:
Solidifications of molten materials.
Escribe lo que piensa de la siguiente suposición si es cierta o no: " Todas las semillas de una fruta sobrevivirán, se convertirán en adultas y tendrán sus propias frutas. " Describa de si esta suposición es verdadera para otros organismos como las bacterias y animales además de las plantas)
Answer:
Esta suposición no es realista, muchas de las semillas no llegarán a la etapa adulta y por lo tanto no podrán generar nueva progenie
Explanation:
Acorde a la teoría de la evolución por selección natural planteada por Darwin, solamente aquellos organismos que se encuentren mejor adaptados al ambiente en el que viven podrán sobrevivir y de este modo perpetuar sus genes en la progenie. Este es un principio que aplica a todos los tipos de organismos vivientes (es decir, plantas, animales, bacterias, etc). Darwin definió a este proceso evolutivo como 'descendencia con modificación', donde aquellos organismos que se encuentren mejor adaptados a su ambiente transmitirán sus rasgos a la descendencia, mientras que aquellos que no se encuentren suficientemente adaptados no podrán sobrevivir.
I need help please help i will give brainliest
Answer:
A
Explanation: ok
Answer:
A
Explanation:
Which homeostatic process is characterized by the diffusion of only water molecules?
active transport
osmosis
passive transport
dynamic equilibrium
Answer:
It is osmosis
Explanation:
factors that affects potential and kinetic energy
Answer:
See Below.
Explanation:
Kinetic energy depends on the potential energy of an object but they both have similar factors as they are inter-related. Kinetic energy is the motion of the object depending on its potential.
Potential energy is a positional based value, it literally means what it says, the potential or possibility for the creation of energy.
To demonstrate this think of dropping a ball off of a building:
The potential energy of that ball will be greater if the ball is dropped from a higher floor than a lower one. It will also be greater or lower depending on the mass of the object (from the formula in physics F=ma or Force = mass x acceleration). Gravity is another factor. If we drop a ball on Earth and then on the Moon, where the gravitational pull is 1/6th that of the Earth's, of course it will not be the same.Describe one similarity and one difference
between the structure of a euglena and
an amoeba.
Answer:
can you give me a pic????
Which of the following statements about a scientific theory is NOT true?
Answer:
sorry, but there are no statements. Maybe you can edit it and add the pictures so we can see them.
.
How many protons, neutrons, and electrons are present in an atom of hafnium, Hf, with a mass number of 178?
Answer:
Name Hafnium
Atomic Mass 178.49 atomic mass units
Number of Protons 72
Number of Neutrons 106
Number of Electrons 72
Answer: 72 protons, 178 neutrons, 106 electrons
Explanation:
what is the structure and function of the mitochondria be sure to relate them
What best describes the relationship between the two sets of reactions of photosynthesis, which are the light-dependent reactions and the light-independent reactions?
Answer:
The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions.
Light-dependent reactions and light-independent reactions both produce each set of sugars, and working together they produce more sugars than they can produce separately.
What are Light-dependent and independent reactions?Light-dependent reactions which convert light energy into chemical energy, so the goal of the light-dependent reactions of photosynthesis is to collect energy from the sun and break down water molecules to form ATP and NADPH, while these two energy storage molecules occur which is used in light-independent reactions.
Light-dependent reactions occur in the thylakoid membrane that use light energy to make ATP and NADPH while in light-independent reactions or the Calvin cycle where electrons activated from light-dependent reactions provide energy to make carbohydrates from carbon dioxide molecules.
Thus, Light-dependent reactions and light-independent reactions both produce each set of sugars, and working together they produce more sugars than they can produce separately.
Learn more about Photosynthesis, here:
https://brainly.com/question/29764662
#SPJ2
In your own words explain how "Carrying Capacity" plays a vital role in today's world and our future as well.
Answer:
Carrying Capacity is very important for today as well as for the future.
Explanation:
Carrying Capacity refers to the maximum population of a particular organism that a specific environment can hold. In each and every environment, there are different population of organisms present due to the availability of resources such as food, water and space for living. If these resources are present in large amount then the population of organism will be higher but if these resources are limited, then the population will be lower. Carrying Capacity is also important for the future because with the passage of time, population of human increases which destroy the forests because human requires area for living. So for cutting of forests, the animals migrated to other areas and sometimes die due to no space available for them.
Help ASAP!!! You’ll get brainiest if you do it right!
What is the complementary DNA strand TAC GGC CGT TAT
Answer:
1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
why do scientist use the term subunits and macromolecules when referring to lipids
Answer:
yes!!!
Explanation:
An apple, potato, and onion all taste the same if you eat them with your nose plugged
ATP and photovoltaic cells are similar because
A. they are both key components of plant cells.
B. they both produce chemical and electrical energy.
C. they are both key components of solar panels.
D. they both use energy from the sun to separate electrons from atoms.
2021 answers
1. they both use energy transport chains
2. ATP
3. stored as chemical energy
4. carbon dioxide + water + light --> sugar + oxygen
5. photosynthesis
100% :) please like if I am correct
Answer:
100% 2022
Explanation:
1. they both use energy transport chains
2. ATP
3. stored as chemical energy
4. carbon dioxide + water + light --> sugar + oxygen
5. photosynthesis
What is the relationship between global winds and global ocean currents?
A. The pattern of global winds is one of the factors that drives global ocean currents
B. The pattern of global ocean currents is one of the factors that drives global winds.
C. Both are caused by heat from the sun, and they do not affect each other.
D. Both are caused by Earth's rotation, and they do not affect each other
Answer: B
Because i said so
The uneven heating of the Earth's surface leads to the formation of large global wind systems. The surface currents of the oceans are in turn driven by these global wind systems. Thus, option B is correct.
What are global winds and global ocean currents?Large-scale surface ocean currents are propelled by global wind systems that are fuelled by solar energy. These currents transport heat from the tropics to the poles, altering the climate on a local as well as global scale.
Friction from the global winds, which both follow the same basic circulation, clockwise in the Northern Hemisphere and counterclockwise in the Southern Hemisphere.
Warm water and precipitation are transported from the equator to the poles by ocean currents, whereas cold water is returned to the tropics from the poles.
Therefore, The pattern of global ocean currents is one of the factors that drives global winds.
Learn more about global ocean currents here:
https://brainly.com/question/9896543
#SPJ2
How does the structure of DNA determine how genetic information is inherited?
Why does a Chlamydomonas organism need to locate light
Answer:
the ability to detect the direction of light, to make the right turn and to stay oriented, is a direct consequence of the helical path of the organism, the orientation of its eyespot relative to the helix-axis, and the special shielding properties of eyespot and cell body.
Explanation:
hope this helps :)
Chlamydomonas is an algae. It is a biflagellate organism. It can swim and therefore, exhibit phototaxis. Chlamydomonas needs to locate light in order to move and grow.
What is Chlamydomonas?Chlamydomonas is a biflagellated algae which exhibits both positive and negative phototaxis. Phototaxis is the directional movement of an organism in response to light (stimulus).
The green alga, Chlamydomonas reinhardtii, can swim toward light (positive phototaxis) to increase photosynthesis, but it can also swim away from bright light (negative phototaxis) to avoid damage to molecular complexes required for photosynthesis.
Chlamydomonas grows at a faster rate with higher light intensity due to its photosynthetic nature, provided all other required nutrients for its growth are constant in all treatments. Light acts as an important factor for growth in these organisms.
Learn more about Chlamydomonas here:
https://brainly.com/question/920441
#SPJ2
How do the isotopes of hydrogen differ? *
Answer:
D. in the number of neutrons :)
Explanation:
An isotope is one of two or more forms of the same chemical element. Different isotopes of an element have the same number of protons in the nucleus, giving them the same atomic number, but a different number of neutrons giving each elemental isotope a different atomic weight.
what venn diagram in math
why should a leaf be attached to it parent plant
when a sperm cell fertilizes an egg cell a new cell is created. what is the name of the newly created cell
a. gastrula
b. zygote
c. blastula
d. endoderm
Answer:
The answer is B, zygote.
PLEASE HELPPPPPPPPPP!!!!!!! Explain how ATP and ADP act as allosteric regulators of enzymes that are responsible for ATP production, and how that is an example of feedback inhibition.
Answer:
The molecules that bind cellular respiration enzymes act as signals, giving the enzyme information about the cell's energy state. ATP and ADP are examples of molecules that regulate cellular respiration enzymes. ATP, for instance, is a "stop" signal: high levels mean that the cell has enough ATP and does not need to make more through cellular respiration.
This is a case of feedback inhibition in which a product feeds back to shut down its pathways.
Answer:
Specific enzymes of the electron transport chain are unaffected by feedback inhibition, but the rate of electron transport through the pathway is affected by the levels of ADP and ATP. Greater ATP consumption by a cell is indicated by a buildup of ADP. As ATP usage decreases, the concentration of ADP decreases: ATP begins to build up in the cell.
Explanation:
