Which option illustrates where the youngest crust is formed?

Question 2 options:

A


B


C


None of them

Answer:

Tissue

Explanation:

Tissue is a group of cells that work together for a specific function such as making your muscles move.

Tissue level of organization is characterized by a group of cells that work together to perform a common function

A group of cells that work together to perform a common function is known as a tissue. Tissues can be classified into four main types: epithelial, connective, muscular, and nervous tissue.

Epithelial tissues are responsible for covering and lining surfaces, while connective tissues provide support and protection to the body. Muscular tissues enable movement, while nervous tissues control and coordinate body functions.

Therefore, Tissues are the building blocks of organs that are made up from cells , which in turn make up organ systems, and ultimately form an organism.

Learn more about Tissue at :

https://brainly.com/question/17664886

#SPJ7

Answer:

D. in the number of neutrons :)

Explanation:

An isotope is one of two or more forms of the same chemical element. Different isotopes of an element have the same number of protons in the nucleus, giving them the same atomic number, but a different number of neutrons giving each elemental isotope a different atomic weight.

Answer:

The answer is B, zygote.

Answer:

The correct answer is - option B. DNA sequences from different species can be compared, giving us more information about their evolutionary relationships.

Explanation:

The study of the evolution of a species in a longer period of time and its evolutionary relation with other species is phylogeny. DNA is the basis of the molecular phylogeny of a species to find out the evolution of species.

Genetic mutations, a sequence of nucleotides, and other information of DNA helps in the establishment of divergence from common ancestry. By comparing the information it gives an idea about the evolutionary ancestry of two or more species.

Answer:

Starch-nucleic acid is not paired correctly.

Answer:

It is a hormone that increases appetite

Answer:

See Below.

Explanation:

Kinetic energy depends on the potential energy of an object but they both have similar factors as they are inter-related. Kinetic energy is the motion of the object depending on its potential.

Potential energy is a positional based value, it literally means what it says, the potential or possibility for the creation of energy.

To demonstrate this think of dropping a ball off of a building:

Answer:

Solidifications of molten materials.

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’

A network of complex interactions formed by the feeding relationships among the various organisms in an ecosystem is known as Food web.

A food web is the natural interconnection of the different food chains and a graphical representation of what-eats-what in an ecological community in the nature. Another name used for the food web is the consumer-resource system.

Organisms which are present in the food webs are grouped into different categories are called as trophic levels. These levels are divided into producers, consumers, and decomposers.

Food web are the interactions which integrates the transfer of matter and energy between the living organisms which eat, and are being eaten by other organisms, capturing thus essential information about the species interactions, materials flow, community structure, and the ecosystem functioning.

Learn more about Food web here:

https://brainly.com/question/18816028

#SPJ6

Answer:

I would go with B:

The body must maintain homeostasis so that the internal environment stays the same if the outside

Homeostasis is the process of a state of steady internal, mental, chemical, and physical conditions of the body.

The correct answer is:

Option B. The body must maintain homeostasis so that the internal environment stays the same if the outside environment changes.

Homeostasis can be explained as:

Thus, the correct answer is Option B.

To know more about homeostasis, refer to the following link:

https://brainly.com/question/860558

2021 answers

1.  they both use energy transport chains

2. ATP

3. stored as chemical energy

4. carbon dioxide + water + light --> sugar + oxygen

5.  photosynthesis

100% :) please like if I am correct

Answer:

100% 2022

Explanation:

1.  they both use energy transport chains

2. ATP

3. stored as chemical energy

4. carbon dioxide + water + light --> sugar + oxygen

5.  photosynthesis

Answer:

It is osmosis

Explanation:

Answer:

The nucleus has very important roles to play. As it contains genetic material, it coordinates cell activities like protein synthesis and cell division. Anatomically the nucleus is made up of several components: nuclear envelope, nuclear lamina, nucleolus, chromosomes, nucleoplasm are some of these components.

Explanation:

The nucleus controls and regulates the activities of the cellular (e.g., growth and metabolism) and carries the genes and systems that include the hereditary statistics.

The nucleus has 2 primary features: it's miles responsible for storing the cell's hereditary cloth or the DNA. it is liable for coordinating the various essential cell activities along with protein synthesis, cellular division, growth, and a bunch of other critical features.

Learn more about nucleus here: https://brainly.com/question/11295582

#SPJ2

Answer:

Osmotic homeostasis is maintained despite the influence of external factors such as temperature, diet, and weather conditions. Osmosis is the diffusion of water across a membrane in response to osmotic pressure caused by an imbalance of molecules on either side of the membrane.

Answer:

Esta suposición no es realista, muchas de las semillas no llegarán a la etapa adulta y por lo tanto no podrán generar nueva progenie

Explanation:

Acorde a la teoría de la evolución por selección natural planteada por Darwin, solamente aquellos organismos que se encuentren mejor adaptados al ambiente en el que viven podrán sobrevivir y de este modo perpetuar sus genes en la progenie. Este es un principio que aplica a todos los tipos de organismos vivientes (es decir, plantas, animales, bacterias, etc). Darwin definió a este proceso evolutivo como 'descendencia con modificación', donde aquellos organismos que se encuentren mejor adaptados a su ambiente transmitirán sus rasgos a la descendencia, mientras que aquellos que no se encuentren suficientemente adaptados no podrán sobrevivir.

Answer:

Name Hafnium

Atomic Mass 178.49 atomic mass units

Number of Protons 72

Number of Neutrons 106

Number of Electrons 72

Answer: 72 protons, 178 neutrons, 106 electrons

Explanation:

Answer:

Question 1 - false

Question 2 - true

Question 3 - true

Question 4 - false

Question 5 - false

Question 6 - false

Question 7 - false

Question 8 - true

Question 9 - true

Question 10 - false

Question 11 - false

Question - false

Question 12 - true

Question 13 - false

Question 14 - true

Answer:

1) All living cells have the same organelles.

false

2) Plant cell walls are primarily made of sugar.

true

3) The environment can cause the shape of a protein to change.

true

4) Turgor pressure is a result of a central vacuole being low or nearly empty of water.

false

5) Mitochondria make sugar for animal cells.

false

6) The space between organelles in a cell is just water

false

7) Proteins are what allow cells to move

true

8) Catalysts are polysaccharide enzymes.

false

9) Of the 5 nucleotides used in RNA and DNA, only one (A) is used for energy transport in the cell.

false

10) Changing the shape of the active site of an enzyme will probably allow it to catalyze more reactions.

false

11) Denaturing a protein makes it permanently unusable by breaking peptide bonds.

false

12) Hydrogen bonds are responsible for the common secondary structures in protein folding.

true

13) Water is an organic molecule.

false

14) Sugars are organic molecules

true

Explanation:

Just took the test!

Answer:

the ability to detect the direction of light, to make the right turn and to stay oriented, is a direct consequence of the helical path of the organism, the orientation of its eyespot relative to the helix-axis, and the special shielding properties of eyespot and cell body.

Explanation:

hope this helps :)

Chlamydomonas is an algae. It is a biflagellate organism. It can swim and therefore, exhibit phototaxis. Chlamydomonas needs to locate light in order to move and grow.

Chlamydomonas is a biflagellated algae which exhibits both positive and negative phototaxis. Phototaxis is the directional movement of an organism in response to light (stimulus).

The green alga, Chlamydomonas reinhardtii, can swim toward light (positive phototaxis) to increase photosynthesis, but it can also swim away from bright light (negative phototaxis) to avoid damage to molecular complexes required for photosynthesis.

Chlamydomonas grows at a faster rate with higher light intensity due to its photosynthetic nature, provided all other required nutrients for its growth are constant in all treatments. Light acts as an important factor for growth in these organisms.

Learn more about Chlamydomonas here:

https://brainly.com/question/920441

#SPJ2

Answer:  B

Because i said so

The uneven heating of the Earth's surface leads to the formation of large global wind systems. The surface currents of the oceans are in turn driven by these global wind systems. Thus, option B is correct.

Large-scale surface ocean currents are propelled by global wind systems that are fuelled by solar energy. These currents transport heat from the tropics to the poles, altering the climate on a local as well as global scale.

Friction from the global winds, which both follow the same basic circulation, clockwise in the Northern Hemisphere and counterclockwise in the Southern Hemisphere.

Warm water and precipitation are transported from the equator to the poles by ocean currents, whereas cold water is returned to the tropics from the poles.

Therefore, The pattern of global ocean currents is one of the factors that drives global winds.

Learn more about global ocean currents here:

https://brainly.com/question/9896543

#SPJ2

Answer:

Carrying Capacity is very important for today as well as for the future.

Explanation:

Carrying Capacity refers to the maximum population of a particular organism that a specific environment can hold. In each and every environment, there are different population of organisms present due to the availability of resources such as food, water and space for living. If these resources are present in large amount then the population of organism will be higher but if these resources are limited, then the population will be lower. Carrying Capacity is also important for the future because with the passage of time, population of human increases which destroy the forests because human requires area for living. So for cutting of forests, the animals migrated to other areas and sometimes die due to no space available for them.

Answer:

C

Explanation:

I'm pretty sure it's either C or B

Answer:

yes!!!

Explanation:

An apple, potato, and onion all taste the same if you eat them with your nose plugged

Answer:

The box would it weighs more. I hope this helps. so sorry if this is wrong.

Explanation:

Answer:

can you give me a pic????

Answer:

The molecules that bind cellular respiration enzymes act as signals, giving the enzyme information about the cell's energy state. ATP and ADP are examples of molecules that regulate cellular respiration enzymes. ATP, for instance, is a "stop" signal: high levels mean that the cell has enough ATP and does not need to make more through cellular respiration.

This is a case of feedback inhibition in which a product feeds back to shut down its pathways.

Answer:

Specific enzymes of the electron transport chain are unaffected by feedback inhibition, but the rate of electron transport through the pathway is affected by the levels of ADP and ATP. Greater ATP consumption by a cell is indicated by a buildup of ADP. As ATP usage decreases, the concentration of ADP decreases: ATP begins to build up in the cell.  

Explanation:

Answer:

The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions.

Light-dependent reactions and light-independent reactions both produce each set of sugars, and working together they produce more sugars than they can produce separately.

Light-dependent reactions which convert light energy into chemical energy, so the goal of the light-dependent reactions of photosynthesis is to collect energy from the sun and break down water molecules to form ATP and NADPH, while these two energy storage molecules occur which is used in light-independent reactions.

Light-dependent reactions occur in the thylakoid membrane that use light energy to make ATP and NADPH while in light-independent reactions or the Calvin cycle where electrons activated from light-dependent reactions provide energy to make carbohydrates from carbon dioxide molecules.

Thus, Light-dependent reactions and light-independent reactions both produce each set of sugars, and working together they produce more sugars than they can produce separately.

Learn more about Photosynthesis, here:

https://brainly.com/question/29764662

#SPJ2