Answer:
B. 0.1
Explanation:
Trust me
Answer:
(b) 0.1 m
Explanation:
edge 2022
What is the percentage of recorded pulse rate (62-69)
Answer:
A normal resting heart rate can range anywhere from 40 to 100 beats per minute. Below is a chart relating resting heart rate and fitness level.
Explanation:
Answer:
40 to 100 beats per minute
Explanation:
Health class in college is how I know
Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:
Answer:
y is there so much letters?
Which of the following does not describe a source of greenhouse gases?
Steam of fossil fuels
Burning of fossil fuels
Freezing of permafrost
Emissions from landfills
Answer:
i think its C) Freezing of perma frost
Explanation:
The option that does not describe a source of greenhouse gases is the freezing of glaciers. Thus, the correct option is C.
What are greenhouse gases?Greenhouse gases may be defined as those gases that are present in the earth's atmosphere and trap the heat and radiation from the sun and emitted toward the earth.
Such greenhouse gases are responsible for the greenhouse effect that ultimately leads to global warming.
Steaming and burning of fossil fuels and emissions from landfills extremely liberated the high amount of carbon dioxide in the atmosphere which is one of the most potent greenhouse gas.
Therefore, the option that does not describe a source of greenhouse gases is the freezing of glaciers (hailstone). Thus, the correct option is C.
To learn more about Greenhouse gases, refer to the link:
https://brainly.com/question/12684997
#SPJ2
using your knowledge of photosynthesis, explain what is meant by the sentence “plants give us what we need and we give plants what they need.”
what noble gas is the most abundant in the atmosphere?
Answer:
The most abundant noble gas in atmosphere is Argon
Select the correct answer.
How is relative-age dating used to determine the ages
of fossils?
• A.
by observing the formation of sedimentary rocks
O B.
by using radioactive isotopes
O C.
by estimating the number of fossils in a particular region
O D.
by the formation of igneous rocks
• E.
by identifying the way the fossils were formed
Answer:
A.
Explanation: By observing the formations you will see the layers of the earth.
which organ system is responsible for protection against injury, infection, and dehydration?
Answer:
The integumentary system protects the body's internal living tissues and organs, protects against invasion by infectious organism, and protects the.body from dehydration.
Explanation:
Which of the following statements is not a characteristic of the prokaryotes.
Prokaryotes don't have a nucleus.
Prokaryotes have a cell wall.
All of the chemical processes take place in membrane bound organelles in the cytoplasm.
Answer:
All the chemical processes take place in membrane bound organelles in the cytoplasm.
Explanation:
Use the process of elimination:
One of the main things that make a prokaryote is not having a nucleus, so that can be eliminated.
Looking at the structure of bacteria, they can have a cell wall, so this is eliminated.
Therefore, “all the chemical processes take place in membrane bound organelles in the cytoplasm” is incorrect.
Also, prokaryotes DO NOT have membrane bound organelles like mitochondria, chloroplasts, or a nucleus, so this statement would also be incorrect because of this.
insects
APPLY Identify the biotic and abiotic components of the taiga ecosystem shown here. Can
you list a few more biotic and abiotic components that might be a part of this ecosystem?
plants
sunlight
elk
air
snow
abiotic
biotic
ha
Answer:
Is there more to this question I actually might be able to help
Explanation:
which is the main receptive portion of the neuron?
Answer:dendrites
The dendrites make up the receptive portion of the neuron, and receive most synaptic afferent inputs from upstream neurons. Cell body. The cell body, also the soma, is the integrative portion of the neuron, where incoming signals from dendrites are summed together.
Explanation:
brainliest pls
Frederick Griffith made a scientific discovery in 1928. Which best describes
the knowledge about genetics before 1928?
Answer:
Frederick Griffith's discovery on the theory of genetics is credited to his experiment on mice. He subjected them to different strains of pneumonia bacteria. He concluded that there is an unidentified force that leads to the formation of different strains from what the mice were subjected to. This leads to the discovery of DNA, the carrier of traits. Scientist before did not know how the trait is passed on not until Griffith's experiment.
Explanation:
True or False: The radius is the bone in the forearm that is on the same side as the pinky finger.
Answer:
false. ulna is on pinky side, radius is on thumb side
Explanation:
Answer:
False
Explanation:
2.3 content quiz (Anatomy Plato)
what do the roman numerals in the pedigree diagram represent?
Answer:
I think it is supposed to be generation so 1st and 2nd generation in this case.
Explanation:
Answer:
Roman Numeral stands for the generation in the family
Explanation:
https://www.cs.cmu.edu/~genetics/units/instructions/instructions-PBA.pdf
Pedigree Analysis
. What does the term mutation mean in regards to human genetics?
Answer:
A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during cell division, exposure to ionizing raditation, exposure to chemicals called mutagens, or infected by viruses.
Explanation:
A mutation is a change in a DNA sequence.
the group of macromolecules that stores and transmits genetic information is:
Answer: nucleic acids
Explanation:
what are four examples of nutrients cycled in a biogeochemical cycle
Answer:
The Gaseous cycles include those of nitrogen, oxygen, carbon, and water; while the sedimentary cycles include those of iron, calcium, phosphorus, sulfur, and other more-earthbound elements.
Explanation:
Major examples are carbon, phosphorus, nitrogen, and oxygen in nutrient cycles in the biogeochemical cycle.
What are important nutrients in the biogeochemical cycle?Most of the elements are important to flow in the ecosystem to obtain living things and their surrounding environment in a balanced state.
This cyclic flow provides energy at every level in the ecosystem, carbon is an important substance synthesis during the photosynthesis process and this plays role in energy molecule flow in a particular direction.
In the biogeochemical cycle carbon cycle, oxygen cycle, nitrogen, and phosphorus cycle flow between the living organism and nonliving matter.
Therefore nitrogen, phosphorus, oxygen, and carbon are major nutrients in a biogeochemical cycle.
Learn more about the biogeochemical cycle, here:
#SPJ2
there is a net movement of water into a cell from the surrounding tissue fluid. is the tissue fluid more or less concentrated than the fluid inside of the cell?
Why are non-native, invasive species sometimes problematic for ecosystem stability?
Answer:
The bring problems with them.
Explanation:
For example if you bring a insect from over seas and it gets releast into a farm land it could kill off all the crops.
Kids' behaviors are influenced by which of the following: (Check all that apply)
hormones
social influences
genes
parental influence
Answer:
parental influence
Ok Its coorrect hope
All of the options hormones, social influences, genes and parental influence can influence a child's behavior.
What influences child's behavior?Hormones can play a role in mood and emotional regulation, which can affect behavior. Social influences, such as the behavior of peers and cultural expectations, can also influence a child's behavior. Genes can also play a role in determining certain characteristics and behaviors.
Finally, parental influence, including the way that parents model behavior and teach and discipline their children, can also affect a child's behavior.
Learn more about child's behavior, here:
https://brainly.com/question/29455765
#SPJ2
slurring words together at a low level of volume and pitch is called
What type of organism is the tuberculosis bacterium, a multicellular or unicellular organism? Explain.
Answer:
Explanation:
Multicellular
You wake up in the morning and get out of bed. Does the floorfeel cold or warm on your bare feet? On the lines below, write asentence that compares how it feels to step on a bare floor and ona rug on a cold morning.
which best describes seeds and their role in the alteration of generations life cycle?
What is the number of chromosomes in each Meiosis I daughter cell
Answer:23 chromosomes
Explanation:
To take human being for example,
There is 46 chromosomes in a human cell, and half is from father, and the other half is from mother. We call the chromosome is a pair. We write it 2n= 46.
In the meiosis I, the chromosomes is 1n=23.
Plz help:
b. Compare dominant and recessive traits –
c. Compare pure and hybrid offspring –
Answer:
b. What is the difference between dominant and recessive traits? Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.
c. In the simplest possible terms, purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.
Explanation:
Answer:
b. Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.
Explanation:
c. purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.
Why is nitrogen a vital element to biotic factors?
LAB Questions for Scientific Method Table 1 Circumference Volume Trial #1 65.4 cm Trial #2 65.3 cm Trial #3 65.5 cm Average
Explanation:
hmmm all of u stay safe
4301154259
Pas 1234
The seasons Earth experiences result from —
A. the Earth rotating on its axis while it revolves around the Sun.
B. the Earth being tilted on its axis while it revolves around the Sun.
C. the Sun moving near the Earth.
D. the Earth moving near the Sun.
Answer:
B. the Earth being tilted on its axis while it revolves around the Sun.
Answer:
Seasons occur because Earth is tilted on its axis relative to the orbital plane, the invisible, flat disc where most objects in the solar system orbit the sun. ... In June, when the Northern Hemisphere is tilted toward the sun, the sun's rays hit it for a greater part of the day than in winter.
Explanation:
your answer is B.
what happens when layers of rock with different densities collide?
quién me ayudaría a hacer este crusigrama
gracias
Answer:
Respuesta: hola ami me parece que ya lo hiciste pero te dejo ejemplos:
Explicación: 1.Venezuela
2. Sanclemente
3. Marroquin
me das corona plis chau
Explanation:
